![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-519a-2 |
||||||||||||||
Accession | MI0003182 (change log) | |||||||||||||
Symbol | HGNC:MIR519A2 | |||||||||||||
Description | Homo sapiens miR-519a-2 stem-loop | |||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||
Literature search |
![]()
34 open access papers mention hsa-mir-519a-2 | |||||||||||||
Stem-loop |
u u c c a guug u 5' ucucaggc gug c cucua aggga gcgcuuucu uc g |||||||| ||| | ||||| ||||| ||||||||| || a 3' agaguuug cau g gagau uuccu cgugaaagg ag a u u u u a --aa a |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-519a-2-5p |
|
Accession | MIMAT0037327 |
Sequence |
15 - ccucuacagggaagcgcuuuc - 35 |
Deep sequencing | 564 reads, 30 experiments |
Evidence | experimental; Illumina [3] |
Mature sequence hsa-miR-519a-3p |
|
Accession | MIMAT0002869 |
Previous IDs | hsa-miR-519a |
Sequence |
54 - aaagugcauccuuuuagagugu - 75 |
Deep sequencing | 8268 reads, 54 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:25822230
"Selective microRNA-Offset RNA expression in human embryonic stem cells"
PLoS One. 10:e0116668(2015).
|