Stem-loop sequence hsa-mir-504

Accession

MI0003189 (change log)

Symbol

HGNC:MIR504

Description

Homo sapiens miR-504 stem-loop

Gene family

MIPF0000437; mir-504

Literature search

27 open access papers mention hsa-mir-504
(170 sentences)

Stem-loop

      -g    -            g          -a  u   u 
5' gcu  cugu ugggagacccug ucugcacucu  uc gua u
   |||  |||| |||||||||||| ||||||||||  || |||  
3' cgg  gaca acccuuugggac ggacgugagg  ag cau c
      ga    u            g          ga  u   u 

Deep sequencing

14733 reads, 4.07 reads per million, 123 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 138667711-138667793 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000058564 ; MCF2-006; intron 11

  OTTHUMT00000058563 ; MCF2-005; intron 14

  OTTHUMT00000058561 ; MCF2-003; intron 22

  OTTHUMT00000058560 ; MCF2-002; intron 23

  OTTHUMT00000058562 ; MCF2-004; intron 24

  OTTHUMT00000058559 ; MCF2-001; intron 26

  OTTHUMT00000377602 ; MCF2-008; intron 27

  ENST00000437564 ; MCF2-006; intron 11

  ENST00000446225 ; MCF2-005; intron 14

  ENST00000536274 ; MCF2-203; intron 21

  ENST00000370573 ; MCF2-003; intron 22

  ENST00000370576 ; MCF2-002; intron 23

  ENST00000338585 ; MCF2-004; intron 24

  ENST00000520602 ; MCF2-001; intron 26

  ENST00000370578 ; MCF2-201; intron 26

  ENST00000414978 ; MCF2-202; intron 26

  ENST00000519895 ; MCF2-008; intron 27

Database links

• EntrezGene:MIR504
• HGNC:MIR504
• RNAcentral:URS00006F1C02_9606
• miRBase Tracker:MI0003189

Mature sequence hsa-miR-504-5p

• Accession: MIMAT0002875
• Sequence: 13 - agacccuggucugcacucuauc - 34
• Deep sequencing: 14589 reads, 122 experiments
• Evidence: experimental; array-cloned [1], cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00005CC20C_9606
• Predicted targets:
  • miRDB:hsa-miR-504-5p
  • microrna.org:hsa-miR-504-5p

Mature sequence hsa-miR-504-3p

• Accession: MIMAT0026612
• Sequence: 50 - gggagugcagggcaggguuuc - 70
• Deep sequencing: 129 reads, 52 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:hsa-miR-504-3p
  • miRDB:hsa-miR-504-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).