![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-504 |
|||||
Accession | MI0003189 (change log) | ||||
Symbol | HGNC:MIR504 | ||||
Description | Homo sapiens miR-504 stem-loop | ||||
Gene family | MIPF0000437; mir-504 | ||||
Literature search |
![]()
27 open access papers mention hsa-mir-504 | ||||
Stem-loop |
-g - g -a u u 5' gcu cugu ugggagacccug ucugcacucu uc gua u ||| |||| |||||||||||| |||||||||| || ||| 3' cgg gaca acccuuugggac ggacgugagg ag cau c ga u g ga u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-504-5p |
|
Accession | MIMAT0002875 |
Sequence |
13 - agacccuggucugcacucuauc - 34 |
Deep sequencing | 14589 reads, 122 experiments |
Evidence | experimental; array-cloned [1], cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-504-3p |
|
Accession | MIMAT0026612 |
Sequence |
50 - gggagugcagggcaggguuuc - 70 |
Deep sequencing | 129 reads, 52 experiments |
Evidence | experimental; Illumina [3] |
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|