MIR506 is a microRNA that is upregulated in the intrahepatic bile duct of patients with primary biliary cholangitis (PBC) and regulates the secretion of biliary epithelial cells (BECs) by targeting AE2 [PMC8147992]. However, a specific interaction between endogenously expressed miR124 and MIR506 does not account for the decrease in expression level in astrocytic cells [PMC5476465]. In pancreatic ductal adenocarcinoma (PDAC), the replacement of MIR506 induces autophagy [PMC9312874]. Overexpression of MIR506 leads to an increase in BCL2 gene expression [PMC7477680]. Low expression levels of MIR506 may contribute to higher levels of CDK6 and CTNNB1 mRNAs in adrenocortical carcinomas (ACCs) [PMC5764399]. MIR506 is part of a group of noncoding RNAs, including miR-34, miR-155, and miR-21, that regulate the reactive oxygen species-cancer axis in various malignancies, including lung cancer [PMC9442502]. In T-cell acute lymphoblastic leukemia (TALL), transfection with MIR506 leads to an increase in its own expression [PMC7477680]. In wheat, 58 miRNAs have been discovered, including MIR506, which targets AB182944 encoding a knox1b homeobox protein [PMC5360763]. Finally, PCR analysis using specific primers reveals binding sites for SOX9 and TEAD1 on the promoters of SOX9 and MIR506 genes respectively [PMC6756096].
caucagccaua - --g c A UA A u gccaccac cuaugu gua ugc uUAUUCAGGA GGUGU CUUA uagau a |||||||| |||||| ||| ||| |||||||||| ||||| |||| ||||| cgguggug gguaca cgu aug GAUGAGUCUU CCACG GAAU guuua a --uuuacaaca a gua A C -- - u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002878 |
Description | Homo sapiens hsa-miR-506-3p mature miRNA |
Sequence | 71 - UAAGGCACCCUUCUGAGUAGA - 91 |
Evidence |
experimental
array-cloned [1] |
Database links | |
Predicted targets |
Accession | MIMAT0022701 |
Description | Homo sapiens hsa-miR-506-5p mature miRNA |
Sequence | 35 - UAUUCAGGAAGGUGUUACUUAA - 56 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|