Accession
MI0003195
Symbol
HGNC:
MIR508
Description
Homo sapiens
hsa-mir-508 precursor miRNA
Gene family
MIPF0000130;
mir-506
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR508 is a microRNA that is expressed in rice and has been found to confer enhanced tolerance to salt stress and nitrogen starvation in creeping bentgrass. This is achieved through the modification of the transcription of AsAAO and COPPER ION BINDING PROTEIN1 (AsCBP1), which are involved in salt response and nitrogen starvation adaptation, respectively [PMC5916090]. The miRNA-mediated salt response is primarily achieved by influencing various factors such as water retention, cell membrane integrity, chlorophyll content, cellular potassium homeostasis, as well as the activity of CATALASE (CAT) and ASCORBIC ACID OXIDASE (AAO) [PMC5916090]. On the other hand, miRNA-modulated nitrogen starvation adaptation involves regulating biomass production, nitrogen accumulation, chlorophyll synthesis, and NITRITE REDUCTASE (NiR) activity [PMC5916090]. MIR508 has been found to be part of a cluster of miRNAs known as the "fragile-X miRNA (FX-MIR)" cluster. This cluster includes miR506, MIR508, miR509-1, miR509-3, and miR510 [PMC9130735]. The expression pattern of MIR508 has been observed in various parts of wheat plants such as stems and internodes but not in leaves or roots [PMC2394755]. Additionally, the expression levels of MIR508 were validated through semi-quantitative RT-PCR analysis [PMC2394755]. Overall, MIR508 plays a crucial role in conferring tolerance to salt stress and nitrogen starvation by regulating specific genes involved in these processes. Its expression pattern suggests its importance in plant development and stress response.
Literature search
28 open access papers mention hsa-mir-508
(76 sentences)
(76 sentences)
Sequence
118049
reads,
1811
reads per million, 47 experiments
ccaccuucagcugaguguagugcccUACUCCAGAGGGCGUCACUCAUGuaaacuaaaacaUGAUUGUAGCCUUUUGGAGUAGAguaauacacaucacguaacgcauauuuggugg
(((((....((((((((((.(((.((((((((((((((..((.((((((........)))))).))..)))))))))))))).))).))))).)))......))......)))))
(((((....((((((((((.(((.((((((((((((((..((.((((((........)))))).))..)))))))))))))).))).))))).)))......))......)))))
Structure
--uuca ------ - g c GU C aaa
ccacc gc uga gugua ugc cUACUCCAGAGGGC CA UCAUGu c
||||| || ||| ||||| ||| |||||||||||||| || ||||||
ggugg cg acu cacau aug GAUGAGGUUUUCCG GU AGUaca u
uuuaua caaugc a a A AU U aaa
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chrX: 147236913-147237027 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-508
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-508 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-508-5p
| Accession | MIMAT0004778 |
| Description | Homo sapiens hsa-miR-508-5p mature miRNA |
| Sequence | 26 - UACUCCAGAGGGCGUCACUCAUG - 48 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-508-3p
| Accession | MIMAT0002880 |
| Description | Homo sapiens hsa-miR-508-3p mature miRNA |
| Sequence | 61 - UGAUUGUAGCCUUUUGGAGUAGA - 83 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
References
|
