Stem-loop sequence ppt-MIR319a

AccessionMI0003496 (change log)
DescriptionPhyscomitrella patens miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention ppt-MIR319a
(23 sentences)

Stem-loop 
             g           u  ug    c a        g u  c c g   aau  c    c     u   -           
5' guggagcucc uuucgguccaa ag  gcug g cggaaggu g cc g u ccg   ca acgu cgggu gcu uaucggggca 
   |||||||||| ||||||||||| ||  |||| | |||||||| | || | | |||   || |||| ||||| ||| ||||||||| g
3' caccucgagg gaagucagguu uc  cggc c gccuucca c gg c a ggc   gu ugca gccua ugg auagccccgg 
             -           c  ug    - c        g u  u a g   ccu  u    a     -   c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 5641294-5641462 [+]
intergenic
Database links

Mature sequence ppt-miR319a

Accession MIMAT0003133
Sequence

148 -  

cuuggacugaagggagcucc

 - 167

Get sequence
Evidence experimental; cloned [1], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).