Stem-loop sequence ppt-MIR319d

Accession

MI0003499 (change log)

Description

Physcomitrella patens miR319d stem-loop

Gene family

MIPF0000010; MIR159

Literature search

3 open access papers mention ppt-MIR319d
(15 sentences)

Stem-loop

        u      uu           u  ug         a      u  u   g   ac   a  uuc   c    c  u   a 
5' cagcg ggagcu  cuucgguccaa ag  gcugagucg agguug gc gcu ccg  uca ac   cgg uucc ua cca c
   ||||| ||||||  ||||||||||| ||  ||||||||| |||||| || ||| |||  ||| ||   ||| |||| || ||| c
3' gucgc ccucga  gaagucagguu uc  cgauucggc ucuaac ug cga ggc  agu ug   gcc aagg au ggu c
        c      gg           c  ua         c      u  u   g   au   c  uaa   u    u  -   c 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (v3.0): Chr22: 1912128-1912297 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0003499

Mature sequence ppt-miR319d-5p.1

• Accession: MIMAT0004325
• Previous IDs: ppt-miR319d.1*
• Sequence: 8 - gagcuuucuucgguccaaua - 27
• Evidence: experimental; cloned [2]

Mature sequence ppt-miR319d-5p.2

• Accession: MIMAT0004326
• Previous IDs: ppt-miR319d.2*
• Sequence: 29 - uggcugagucgaagguugugc - 49
• Evidence: experimental; cloned [2]

Mature sequence ppt-miR319d-3p

• Accession: MIMAT0003136
• Previous IDs: ppt-miR319d
• Sequence: 145 - cuuggacugaagggagcuccc - 165
• Evidence: experimental; cloned [1], 454 [3]

References

1. PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2. PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3. PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).