miRBase entry: hsa-mir-570

Stem-loop hsa-mir-570


Accession
MI0003577
Symbol
HGNC: MIR570
Description
Homo sapiens hsa-mir-570 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR570 is a microRNA initially identified in airway epithelial cells, where it plays a role in regulating the inflammatory response [PMC9503809]. It has been implicated in the pathological progression of right ventricular hypertrophy by regulating gene expression [PMC9589260]. MIR570 is among the top features that can achieve high classification accuracy for heart failure using a logistic regression classifier [PMC9589260]. MIR570 can increase the expression of CCL4 and CCL5 and inhibit the expression of CCL2 after a strong inflammatory stimulus [PMC9503809]. Genetic variants of MIR570 have been associated with protection against multibacillary leprosy and are linked to decreased expression of this microRNA according to the GTEx database [PMC9503809]. In cancer biology, MIR570 is involved in PD-1/PD-L1 pathways through various mechanisms including epigenetic regulation and is considered a potential surrogate biomarker for PD-L1 expression in different cancer types [PMC7523356; PMC7529545; PMC8640083; PMC7816704]..

Literature search
17 open access papers mention hsa-mir-570
(79 sentences)

Sequence

1960 reads, 14 reads per million, 70 experiments
cuagauaaguuauuaggugggugcAAAGGUAAUUGCAGUUUUUCCCauuauuuuaauugCGAAAACAGCAAUUACCUUUGCaccaaccugauggagu
.........(((((((((.(((((((((((((((((.((((((.(.((((...)))).).)))))).))))))))))))))))).)))))))))...

Structure
cuagauaag         g                 A      C C    u 
         uuauuaggu ggugcAAAGGUAAUUGC GUUUUU C auua  
         ||||||||| ||||||||||||||||| |||||| | |||| u
         gguagucca ccaCGUUUCCAUUAACG CAAAAG g uaau  
------uga         a                 A      C u    u 


Annotation confidence Low
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr3: 195699401-195699497 [+]

Disease association
hsa-mir-570 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-570-3p

Accession MIMAT0003235
Description Homo sapiens hsa-miR-570-3p mature miRNA
Sequence 60 - CGAAAACAGCAAUUACCUUUGC - 81
Evidence experimental
SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-570-5p

Accession MIMAT0022707
Description Homo sapiens hsa-miR-570-5p mature miRNA
Sequence 25 - AAAGGUAAUUGCAGUUUUUCCC - 46
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692