miRBase entry: hsa-mir-584

Stem-loop hsa-mir-584


Accession
MI0003591
Symbol
HGNC: MIR584
Description
Homo sapiens hsa-mir-584 precursor miRNA
Gene family
MIPF0000533; mir-584

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR584 is a microRNA that has been found to be upregulated in the liver [PMC4482373]. It is also involved in pancreatic neuroendocrine tumors (pNETs) and pancreatic ductal adenocarcinoma [PMC9554633]. Other miRNAs identified in pNETs include miR1285, miR550a-5P, and miR1825 [PMC9554633]. In the context of H. pylori-induced inflammation and gastric carcinogenesis, let-7b, miR-103, miR-370, and miR-371-5p are downregulated, while miR-21, miR-25, and MIR584 are upregulated [PMC5081003]. MIR584 has been shown to regulate ovarian cancer progression by targeting lipin-1 [PMC8122924]. Low levels of MIR584 are associated with increased metastasis spreading and poor prognosis in ovarian cancer [PMC8122924]. Depletion of MIR584 expression in ovarian cancer cells leads to increased lipin-1 expression and tumorigenesis [PMC8122924].

Literature search
25 open access papers mention hsa-mir-584
(431 sentences)

Sequence

25963 reads, 403 reads per million, 54 experiments
uagggugaccagccaUUAUGGUUUGCCUGGGACUGAGgaauuugcugggauaugUCAGUUCCAGGCCAACCAGGCUgguuggucucccugaagcaac
(((((.(((((((((...(((((.((((((((((((.(.((((....)))).).)))))))))))).)))))...))))))))).))))).......

Structure
-------     u         UUA     U            G a    g 
       uaggg gaccagcca   UGGUU GCCUGGGACUGA g auuu c
       ||||| |||||||||   ||||| |||||||||||| | ||||  
       guccc cugguuggU   ACCAA CGGACCUUGACU u uagg u
caacgaa     u         CGG     C            g a    g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 149062313-149062409 [-]

Disease association
hsa-mir-584 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-584-5p

Accession MIMAT0003249
Description Homo sapiens hsa-miR-584-5p mature miRNA
Sequence 16 - UUAUGGUUUGCCUGGGACUGAG - 37
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-584-3p

Accession MIMAT0022708
Description Homo sapiens hsa-miR-584-3p mature miRNA
Sequence 55 - UCAGUUCCAGGCCAACCAGGCU - 76
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692