miRBase entry: hsa-mir-590

Stem-loop hsa-mir-590


Accession
MI0003602
Symbol
HGNC: MIR590
Description
Homo sapiens hsa-mir-590 precursor miRNA
Gene family
MIPF0000418; mir-590

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR590 is a microRNA that has been found to be upregulated in various conditions, including in all pulmonary arterial hypertension (PA) cases [PMC7652879]. The MIR590 gene contains a single estrogen receptor alpha (ERα) binding site in its promoter region, located 1050 base pairs upstream of the transcription start site [PMC6328622]. Antisense oligonucleotides against MIR590 have been shown to reverse its effects [PMC7215603]. MIR590 has also been found to target Tob1 and TGFβR2, suggesting its role in cardiac fibrosis and epithelial-mesenchymal transition (EMT) [PMC9564062] [PMC4626157]. Additionally, MIR590 has been associated with myocarditis and heart failure [PMC9589260]. It has also been shown to regulate Sp1 expression levels and be involved in various downstream sub-networks, including glucose metabolism and microRNA regulation [PMC5210349] [PMC6052129]. In cancer, MIR590 acts as an oncogene by targeting PPM1F and is a prognostic factor for tumor recurrence [PMC8743668]. It is also involved in EMT along with miR182 and miR183 [PMC7575175] [PMC8743668].

Literature search
68 open access papers mention hsa-mir-590
(418 sentences)

Sequence

92304 reads, 996 reads per million, 152 experiments
uagccagucagaaauGAGCUUAUUCAUAAAAGUGCAGuauggugaagucaaucugUAAUUUUAUGUAUAAGCUAGUcucugauugaaacaugcagca
....((((((((.((.(((((((.(((((((.(((((..(((.....)))..))))).))))))).))))))).)).))))))))............

Structure
--------uagc        a  G       U       G     ua   u 
            cagucaga au AGCUUAU CAUAAAA UGCAG  ugg g
            |||||||| || ||||||| ||||||| |||||  ||| a
            guuagucu UG UCGAAUA GUAUUUU AUguc  acu a
acgacguacaaa        c  A       U       A     ua   g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 74191198-74191294 [+]

Disease association
hsa-mir-590 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-590-5p

Accession MIMAT0003258
Description Homo sapiens hsa-miR-590-5p mature miRNA
Sequence 16 - GAGCUUAUUCAUAAAAGUGCAG - 37
Evidence experimental
Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-590-3p

Accession MIMAT0004801
Description Homo sapiens hsa-miR-590-3p mature miRNA
Sequence 56 - UAAUUUUAUGUAUAAGCUAGU - 76
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692