Stem-loop hsa-mir-615

Accession

MI0003628

Symbol

HGNC: MIR615

Description

Homo sapiens hsa-mir-615 precursor miRNA

Gene family

MIPF0000342; mir-615

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR615 is a microRNA that has been found to be significantly downregulated in osteosarcoma patient tissues and is correlated with poor clinical outcomes [PMC9441498]. It is located within the HOXC cluster on chromosome 13 and has been implicated in prostate and colon cancer [PMC4620477]. MIR615 encodes two microRNAs, MIR615-5p and MIR615-3p [PMC4620477]. The region encoding MIR615-3p has been targeted using sgRNA expression plasmids in experiments involving colorectal carcinoma cells [PMC4620477]. The epigenetic regulation of MIR615, which is located within a CpG island, is a novel discovery [PMC3037319]. In pancreatic ductal adenocarcinoma (PDAC), MIR615 has been found to be differentially expressed and associated with PDAC progression [PMC10057657]. It has also been associated with CAG length in the meta-analysis of data from PDAC patients [PMC5764268]. In addition, MIR615 has been shown to inhibit cell proliferation, migration, and invasion in vitro [PMC10057657]. Furthermore, it interacts with several protein-coding genes, miRNAs, lncRNAs, rRNAs, and other non-coding RNAs [PMC9730017]. Overall, the dysregulation of MIR615 expression and its interactions with various genes suggest its potential role in cancer development and progression.

Literature search

29 open access papers mention hsa-mir-615
(246 sentences)

Sequence

8792 reads, 215 reads per million, 105 experiments

cucgggaggggcgggagGGGGGUCCCCGGUGCUCGGAUCucgagggugcuuauuguucggUCCGAGCCUGGGUCUCCCUCUUccccccaacccccc
...(((..(((.((((((((((..(((((.((((((((..((((.(.......).)))))))))))))))))...)))))))))))))..)))...

Structure

cuc   ag   c          -UC     U        Cu    g ug 
   ggg  ggg gggagGGGGG   CCCGG GCUCGGAU  cgag g  c
   |||  ||| ||||||||||   ||||| ||||||||  |||| |  u
   ccc  ccc cccUUCUCCC   GGGUC CGAGCCUg  gcuu u  u
ccc   aa   -          UCU     -        --    g ua 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr12: 54033950-54034045 [+]

Disease association

hsa-mir-615 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-615-5p

• Accession: MIMAT0004804
• Description: Homo sapiens hsa-miR-615-5p mature miRNA
• Sequence: 18 - GGGGGUCCCCGGUGCUCGGAUC - 39
• Evidence: experimental ; cloned [2]

Mature hsa-miR-615-3p

• Accession: MIMAT0003283
• Description: Homo sapiens hsa-miR-615-3p mature miRNA
• Sequence: 61 - UCCGAGCCUGGGUCUCCCUCUU - 82
• Evidence: experimental ; RT-PCR [1], SAGE [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692