MIR615 is a microRNA that has been found to be significantly downregulated in osteosarcoma patient tissues and is correlated with poor clinical outcomes [PMC9441498]. It is located within the HOXC cluster on chromosome 13 and has been implicated in prostate and colon cancer [PMC4620477]. MIR615 encodes two microRNAs, MIR615-5p and MIR615-3p [PMC4620477]. The region encoding MIR615-3p has been targeted using sgRNA expression plasmids in experiments involving colorectal carcinoma cells [PMC4620477]. The epigenetic regulation of MIR615, which is located within a CpG island, is a novel discovery [PMC3037319]. In pancreatic ductal adenocarcinoma (PDAC), MIR615 has been found to be differentially expressed and associated with PDAC progression [PMC10057657]. It has also been associated with CAG length in the meta-analysis of data from PDAC patients [PMC5764268]. In addition, MIR615 has been shown to inhibit cell proliferation, migration, and invasion in vitro [PMC10057657]. Furthermore, it interacts with several protein-coding genes, miRNAs, lncRNAs, rRNAs, and other non-coding RNAs [PMC9730017]. Overall, the dysregulation of MIR615 expression and its interactions with various genes suggest its potential role in cancer development and progression.
cuc ag c -UC U Cu g ug ggg ggg gggagGGGGG CCCGG GCUCGGAU cgag g c ||| ||| |||||||||| ||||| |||||||| |||| | u ccc ccc cccUUCUCCC GGGUC CGAGCCUg gcuu u u ccc aa - UCU - -- g ua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004804 |
Description | Homo sapiens hsa-miR-615-5p mature miRNA |
Sequence | 18 - GGGGGUCCCCGGUGCUCGGAUC - 39 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0003283 |
Description | Homo sapiens hsa-miR-615-3p mature miRNA |
Sequence | 61 - UCCGAGCCUGGGUCUCCCUCUU - 82 |
Evidence |
experimental
RT-PCR [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
|