Stem-loop hsa-mir-627

Accession

MI0003641

Symbol

HGNC: MIR627

Description

Homo sapiens hsa-mir-627 precursor miRNA

Gene family

MIPF0000550; mir-627

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR627 is a microRNA that is downregulated under hypoxic conditions, as shown by a ChIP assay using an antibody against H3K9ac (histone H3 acetylation) [PMC8317525]. The decreased acetylation of histone H3 across the MIR627 promoter region correlates with the downregulation of MIR627 expression [PMC8317525]. Conversely, the knockdown of HDAC3, a histone deacetylase, leads to increased acetylation levels and expression of MIR627 [PMC8317525]. The regulation of MIR627 by hypoxia is found to be HIF-1α-dependent but not through direct binding to the hypoxia response element (HRE) sites on the MIR627 gene promoter region [PMC8317525'>PMC8317525]. Additionally, it is shown that HDAC3-mediated histone deacetylation in the promoter region of MIR627 plays a critical role in hypoxia-mediated repression of miR-627-5p [PMC8317525]. ChIP assay using an antibody against H3K9ac confirms decreased histone H3 acetylation across the MIR627 promoter region under hypoxic conditions and this repression can be reversed by HDAC3 knockdown [PMC8317525]. Furthermore, it is noted that variants in the mature miRNA sequence can result in altered target specificity, as demonstrated by a variant in the seed sequence of MIR627 [PMC4756848].

Literature search

10 open access papers mention hsa-mir-627
(15 sentences)

Sequence

2946 reads, 103 reads per million, 96 experiments

uacuuauuacugguaGUGAGUCUCUAAGAAAAGAGGAggugguuguuuuccuccUCUUUUCUUUGAGACUCACUaccaauaauaagaaauacuacua
..(((((((.((((((((((((((.((((((((((((((.((....)).)))))))))))))).)))))))))))))).)))))))...........

Structure

---------ua       c              U              u  u 
           cuuauua ugguaGUGAGUCUC AAGAAAAGAGGAgg gg u
           ||||||| |||||||||||||| |||||||||||||| ||  
           gaauaau accaUCACUCAGAG UUCUUUUCUccucc uu g
aucaucauaaa       a              U              u  u 

Annotation confidence High

Genome context

chr15: 42199570-42199666 [-]

Disease association

hsa-mir-627 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-627-5p

• Accession: MIMAT0003296
• Description: Homo sapiens hsa-miR-627-5p mature miRNA
• Sequence: 16 - GUGAGUCUCUAAGAAAAGAGGA - 37
• Evidence: experimental ; SAGE [1], cloned [2]

Mature hsa-miR-627-3p

• Accession: MIMAT0026623
• Description: Homo sapiens hsa-miR-627-3p mature miRNA
• Sequence: 55 - UCUUUUCUUUGAGACUCACU - 74
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692


3. PubMed ID: 23226537
   The repertoire and features of human platelet microRNAs
   Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
   PLoS One (2012) 7:e50746