miRBase entry: hsa-mir-641

Stem-loop hsa-mir-641


Accession
MI0003656
Symbol
HGNC: MIR641
Description
Homo sapiens hsa-mir-641 precursor miRNA
Gene family
MIPF0000679; mir-641

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR641 is a microRNA that has been implicated in various biological processes and diseases [PMC2885343]. In the context of testicular germ cell cancer (TGCC), the down-regulation of MIR641 has been associated with the repression of the DMRT1 gene and a subsequent decrease in PTGDS gene expression in human fetal testis [PMC6195803]. In order to study the effects of MIR641 on DMRT1, first and second-trimester human fetal testis tissue was transduced with either MIR641, miR536 (another miRNA targeting DMRT1), or a scrambled control [PMC6195803]. The repression of DMRT1 was observed at the protein level in both trimesters, but only second-trimester tissue transduced with MIR641 showed a reduction in DMRT1 mRNA transcript level [PMC6195803]. Additionally, exposure to either miR536 or MIR641 resulted in a loss of DMRT1 protein expression in Sertoli cells [PMC6195803'>PMC6195803]. The study also found that R-spondin 1 expression was downregulated in tissue transduced with either miR536 or MIR641, while SOX8 expression was reduced following exposure to both miR536 and MIR641 [PMC6195803]. Furthermore, it was observed that knockdown of DMRT1 using either miR536 or MIR641 did not significantly affect inter-individual variation in DMRT gene expression [PMC6195803]. Overall, these findings suggest that MIR641 plays a role in TGCC pathogenesis through its regulation of DMRT1 and associated genes.

Literature search
10 open access papers mention hsa-mir-641
(32 sentences)

Sequence

5404 reads, 167 reads per million, 112 experiments
ugggugaaaggaaggAAAGACAUAGGAUAGAGUCACCUCuguccucuguccucuaccuauagaggugacuguccuaugucuuuccuuccucuuaccccu
.((((((.((((((((((((((((((((..((((((((((((.....(....).....)))))))))))))))))))))))))))))))).))))))..

Structure
-u      a                    AG            ccucu u 
  ggguga aggaaggAAAGACAUAGGAU  AGUCACCUCugu     g c
  |||||| ||||||||||||||||||||  ||||||||||||     |  
  cccauu uccuuccuuucuguauccug  ucaguggagaua     c c
uc      c                    --            uccau u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 40282543-40282641 [-]

Disease association
hsa-mir-641 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-641

Accession MIMAT0003311
Description Homo sapiens hsa-miR-641 mature miRNA
Sequence 16 - AAAGACAUAGGAUAGAGUCACCUC - 39
Evidence experimental
SAGE [1]
Database links
Predicted targets

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692