miRBase entry: hsa-mir-449b

Stem-loop hsa-mir-449b


Accession
MI0003673
Symbol
HGNC: MIR449B
Description
Homo sapiens hsa-mir-449b precursor miRNA
Gene family
MIPF0000133; mir-449

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR449B is a microRNA that is involved in various biological processes and diseases [PMC9855972]. It is a member of the miR-34/449 family, which consists of six homologous miRNAs encoded by three distinct loci [PMC9855972]. Following an ischemic injury to SVZ neural stem cells, the expression of MIR449B was found to change [PMC9405712]. Inhibition of MIR449B and knockdown of Notch1 attenuated the promotion of induced MIR449B [PMC9405712]. MIR449A, MIR449B, and miR449c are highly homologous [PMC6412851]. In HCC progression mediated by LM3 exosomes, six mRNAs containing binding sites for miR449a and/or MIR449B were detected [PMC6412851]. A common polymorphism in MIR449B was found to be protective against sight-threatening diabetic retinopathy (DR) and proliferative DR [PMC7683113]. Studies have identified miR-449a and MIR449B as microRNAs regulated by a specific transcription factor [PMC3756421]. Sperm-born MIR449B has been implicated in the regulation of the timing of the first cleavage in embryos produced through in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT) techniques [PMC5645405]. Additionally, a common polymorphism in MIR499B is associated with a decreased risk of sight-threatening DR in Caucasian patients with type 1 diabetes mellitus (T1DM) [PMC8421969].

Literature search
83 open access papers mention hsa-mir-449b
(414 sentences)

Sequence

4378 reads, 514 reads per million, 49 experiments
ugaccugaaucagguAGGCAGUGUAUUGUUAGCUGGCugcuugggucaagucagCAGCCACAACUACCCUGCCACUugcuucuggauaaauucuucu
...((.(((.(((((.(((((.(((..(((.(.((((((((.((......))))))))))))))))).)))))))))).))).))............

Structure
---------uga  u   u     A     U   UU   A C        u  gu 
            cc gaa caggu GGCAG GUA  GUU G UGGCugcu gg  c
            || ||| ||||| ||||| |||  ||| | |||||||| ||   
            gg cuu guUCA CCGUC CAU  CAA C ACCGACga cu  a
ucuucuuaaaua  u   c     -     C   --   - -        -  ga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 55170646-55170742 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-449b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-449b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-449b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-449b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-449b-5p

Accession MIMAT0003327
Description Homo sapiens hsa-miR-449b-5p mature miRNA
Sequence 16 - AGGCAGUGUAUUGUUAGCUGGC - 37
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-449b-3p

Accession MIMAT0009203
Description Homo sapiens hsa-miR-449b-3p mature miRNA
Sequence 55 - CAGCCACAACUACCCUGCCACU - 76
Evidence experimental
454 [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692