![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hcmv-mir-US4 |
||||||||
Accession | MI0003687 (change log) | |||||||
Description | Human cytomegalovirus miR-US4 stem-loop | |||||||
Stem-loop |
u c c g a - - ga 5' cgugucgcgaca gga gug ag ggg uguc ugucg c u |||||||||||| ||| ||| || ||| |||| ||||| | 3' guacagcgcugu ucu cac uc ccc acag guagu g a c c a g g u u ag |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hcmv-miR-US4-5p |
|
Accession | MIMAT0003341 |
Sequence |
13 - uggacgugcagggggaugucug - 34 |
Evidence | experimental; Northern [1], Illumina [2-3] |
Mature sequence hcmv-miR-US4-3p |
|
Accession | MIMAT0026628 |
Sequence |
52 - ugacagcccgcuacaccucu - 71 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:16140786
"Identification and characterization of human cytomegalovirus-encoded microRNAs"
J Virol. 79:12095-12099(2005).
|
2 |
PMID:22013051
"High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection"
J Virol. 86:226-235(2012).
|
3 |
PMID:22715351
"The microRNA Transcriptome of Human Cytomegalovirus (HCMV)"
Open Virol J. 6:38-48(2012).
|