![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ebv-mir-BART7 |
||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0003729 (change log) | |||||||||||||||||||||||||||||||||||||||||||||
Description | Epstein Barr virus miR-BART7 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000328; mir-BART7 | |||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
- uc a - u aa a cu 5' ucc agug cug uccuggac cu gacuauga ca uu a ||| |||| ||| |||||||| || |||||||| || || 3' agg ucac gac gggaccug ga cugauacu gu aa a c gu a u c ac a aa |
|||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||||
Comments |
mir-BART7 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART11 in [2]. |
|||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence ebv-miR-BART7-5p |
|
Accession | MIMAT0004815 |
Previous IDs | ebv-miR-BART7* |
Sequence |
15 - ccuggaccuugacuaugaaaca - 36 |
Evidence | experimental; cloned [3] |
Mature sequence ebv-miR-BART7-3p |
|
Accession | MIMAT0003416 |
Previous IDs | ebv-miR-BART7 |
Sequence |
51 - caucauaguccaguguccaggg - 72 |
Evidence | experimental; cloned [1,3], array [2], Northern [2] |
References |
|
1 |
PMID:16557291
"Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed"
PLoS Pathog. 2:e23(2006).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|