Stem-loop sequence ebv-mir-BART7

Accession

MI0003729 (change log)

Description

Epstein Barr virus miR-BART7 stem-loop

Gene family

MIPF0000328; mir-BART7

Stem-loop

      -    uc   a        -  u        aa  a  cu 
5' ucc agug  cug uccuggac cu gacuauga  ca uu  a
   ||| ||||  ||| |||||||| || ||||||||  || ||   
3' agg ucac  gac gggaccug ga cugauacu  gu aa  a
      c    gu   a        u  c        ac  a  aa 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

mir-BART7 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART11 in [2].

Genome context

• Coordinates (EMBL:AJ507799.2): HHV507799: 146425-146510 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ebv-mir-BART7

• ebv-mir-BART3: HHV507799: 139076-139154 [+]
• ebv-mir-BART4: HHV507799: 139220-139295 [+]
• ebv-mir-BART1: HHV507799: 139346-139415 [+]
• ebv-mir-BART15: HHV507799: 139507-139584 [+]
• ebv-mir-BART5: HHV507799: 139661-139749 [+]
• ebv-mir-BART16: HHV507799: 139776-139874 [+]
• ebv-mir-BART17: HHV507799: 139894-139995 [+]
• ebv-mir-BART6: HHV507799: 140016-140107 [+]
• ebv-mir-BART21: HHV507799: 145503-145578 [+]
• ebv-mir-BART18: HHV507799: 145932-146050 [+]
• ebv-mir-BART7: HHV507799: 146425-146510 [+]
• ebv-mir-BART8: HHV507799: 146759-146840 [+]
• ebv-mir-BART9: HHV507799: 146946-147032 [+]
• ebv-mir-BART22: HHV507799: 147161-147231 [+]
• ebv-mir-BART10: HHV507799: 147304-147393 [+]
• ebv-mir-BART11: HHV507799: 147524-147609 [+]
• ebv-mir-BART12: HHV507799: 147888-147970 [+]
• ebv-mir-BART19: HHV507799: 148198-148290 [+]
• ebv-mir-BART20: HHV507799: 148319-148417 [+]
• ebv-mir-BART13: HHV507799: 148512-148597 [+]
• ebv-mir-BART14: HHV507799: 148731-148815 [+]
• ebv-mir-BART2: HHV507799: 152745-152806 [+]

Database links

• miRBase Tracker:MI0003729

Mature sequence ebv-miR-BART7-5p

• Accession: MIMAT0004815
• Previous IDs: ebv-miR-BART7*
• Sequence: 15 - ccuggaccuugacuaugaaaca - 36
• Evidence: experimental; cloned [3]

Mature sequence ebv-miR-BART7-3p

• Accession: MIMAT0003416
• Previous IDs: ebv-miR-BART7
• Sequence: 51 - caucauaguccaguguccaggg - 72
• Evidence: experimental; cloned [1,3], array [2], Northern [2]

References

1. PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
2. PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).