Stem-loop ebv-mir-BART11

Accession

MI0003733

Description

Epstein Barr virus ebv-mir-BART11 precursor miRNA

Gene family

MIPF0000993; mir-rL1-14

Sequence

ggcuucuguugggUCAGACAGUUUGGUGCGCUAGUUGugugcuuagcagcaACGCACACCAGGCUGACUGCCuuagcaguguggcc
((((.((((((((.(((.((((((((((.((..(((((.(((...)))))))))).)))))))))).))).))))))))...))))

Structure

    --u        U   A          C  UA     g   u 
ggcu   cuguuggg CAG CAGUUUGGUG GC  GUUGu ugc  
||||   |||||||| ||| |||||||||| ||  ||||| ||| u
ccgg   gacgauuC GUC GUCGGACCAC CG  CAacg acg  
    ugu        C   A          A  --     -   a 

Annotation confidence Not enough data

Comments

mir-BART11 was discovered independently by two groups. Cai et al identified a mature miRNA product from the 3' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART15 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

HHV507799: 147524-147609 [+]

Clustered miRNAs

21 other miRNAs are < 10 kb from ebv-mir-BART11

Disease association

ebv-mir-BART11 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART11-5p

• Accession: MIMAT0003421
• Description: Epstein Barr virus ebv-miR-BART11-5p mature miRNA
• Sequence: 14 - UCAGACAGUUUGGUGCGCUAGUUG - 37
• Evidence: experimental ; array [2], Northern [2], cloned [3]

Mature ebv-miR-BART11-3p

• Accession: MIMAT0003422
• Description: Epstein Barr virus ebv-miR-BART11-3p mature miRNA
• Sequence: 52 - ACGCACACCAGGCUGACUGCC - 72
• Evidence: experimental ; cloned [1,3], array [2], Northern [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16557291
   Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
   Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
   PLoS Pathog (2006) 2:e23


3. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750