Accession
MI0003736
Description
Epstein Barr virus
ebv-mir-BART14 precursor miRNA
Sequence
cagggguggccggUACCCUACGCUGCCGAUUUACAuaauauaaauugUAAAUGCUGCAGUAGUAGGGAUcuggacgcgcgaccug
((((.((((((((..(((((((((((.((((((((..........))))))).).))))).))))))..)))).).)))..))))
((((.((((((((..(((((((((((.((((((((..........))))))).).))))).))))))..)))).).)))..))))
Structure
-g - - UA - C - uaau
cagg gug g ccgg CCCUAC GCUGC G AUUUACA a
|||| ||| | |||| |||||| ||||| | |||||||
gucc cgc c gguc GGGAUG UGACG C UAAAUgu u
ag g a UA A U G uaaa
Annotation confidence
Low
Do you think this miRNA is real?
Comments
mir-BART14 was discovered independently by two groups. Cai et al identified a mature miRNA products from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that both arms give rise to a mature miRNA products, but didnot experimentally determine the extents of those products [2]. The ends of ebv-miR-BART14-3p are therefore predicted, not experimentally determined. This sequence is nisnamed miR-BART20 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations.
Genome context
HHV507799: 148731-148815 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART14
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
ebv-mir-BART14 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature ebv-miR-BART14-5p
| Accession | MIMAT0003425 |
| Description | Epstein Barr virus ebv-miR-BART14-5p mature miRNA |
| Sequence | 14 - UACCCUACGCUGCCGAUUUACA - 35 |
| Evidence |
experimental
cloned [1,3], array [2], Northern [2] |
Mature ebv-miR-BART14-3p
| Accession | MIMAT0003426 |
| Description | Epstein Barr virus ebv-miR-BART14-3p mature miRNA |
| Sequence | 48 - UAAAUGCUGCAGUAGUAGGGAU - 69 |
| Evidence |
experimental
array [2], Northern [2], cloned [3] |
References
|
