MIR671 is a microRNA that has been identified in various studies and has been found to play a role in different biological processes. In one study, six miRNAs, including MIR671, were identified, but only miR1226 showed statistically significant differences [PMC6764711]. Another study found that MIR671 is present in EpCAM-Exos and is one of eight novel miRNAs identified [PMC5137021]. Multiple studies have shown that MIR671, along with other genes such as Lcn2, Cd74, and Cebpd, play a role in the immune response of macrophages and/or microglia as retinal degeneration increases [PMC8362665] [PMC4872275]. Additionally, MIR671 has been found to be involved in regulating extracellular matrix production and acts as a sponge for its target transcript [PMC4872275] [PMC9918958]. In the context of preeclampsia, MIR671 was found to be increased along with other miRNAs associated with various processes such as injury, oxidative stress, inflammation, and hypertension [PMC5933288]. Furthermore, MIR671 was identified as one of the upregulated intragenic miRNAs residing within upregulated genes in non-protein coding regions [PMC5823624]. These findings highlight the diverse roles of MIR671 in different biological contexts.
ggu aa ----a a A A GA u ug gca g cuggc ggcc ggaagagg GGA GCCCUG GGGGCUGGAGg ga g ||| | ||||| |||| |||||||| ||| |||||| ||||||||||| || a cgu c gaccg ccgg cuuucuCC CCU CGGGAC UCUUGGCCUcc uu u ggu gg agaug g A - -- u ug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003880 |
Description | Homo sapiens hsa-miR-671-5p mature miRNA |
Sequence | 29 - AGGAAGCCCUGGAGGGGCUGGAG - 51 |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
Accession | MIMAT0004819 |
Description | Homo sapiens hsa-miR-671-3p mature miRNA |
Sequence | 68 - UCCGGUUCUCAGGGCUCCACC - 88 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|