miRBase entry: hsa-mir-767

Stem-loop hsa-mir-767


Accession
MI0003763
Symbol
HGNC: MIR767
Description
Homo sapiens hsa-mir-767 precursor miRNA
Gene family
MIPF0000552; mir-767

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR767 is a microRNA that has been studied in various contexts. In one study, the level of MIR767 was explored in senescent vascular endothelial cells-derived exosomes and its expression levels were examined after co-culture with skin fibroblasts [PMC9908644]. Additionally, a 214.11-kb duplication in the chromosomal Xq28 region, which includes the GABRA3, MIR105-1, MIR767, and MIR105-2 genes, was identified in a proband via microarray analysis and was inherited from his healthy mother [PMC6894506]. This duplication has been associated with mental development abnormalities [PMC6894506]. In another study comparing miRNA expression levels in PANC-1 cells and hTERT-HPNE cells, it was found that MIR767 showed higher expression levels in PANC-1 cells compared to hTERT-HPNE cells [PMC3849454]. The function of MIR767 is largely unknown at this time [PMC3849454]. Additionally, another miRNA called MIR1269 showed similar expression patterns to MIR767 in the same study. However, its function is also largely unknown except for a potential role during differentiation of human embryonic stem cells [PMC3849454].

Literature search
15 open access papers mention hsa-mir-767
(21 sentences)

Sequence

1986 reads, 325 reads per million, 40 experiments
gcuuuuauauuguagguuuuugcucaUGCACCAUGGUUGUCUGAGCAUGcagcaugcuugUCUGCUCAUACCCCAUGGUUUCUgagcaggaaccuucauugucuacugc
((....(((.((.(((((((((((((...(((((((..((.((((((.((((.....)))).)))))).)).)))))))...))))))))))))).)).))).....))

Structure
  -uuuu   u  u             UGC       UU  C      U    c 
gc     aua ug agguuuuugcuca   ACCAUGG  GU UGAGCA Gcag a
||     ||| || |||||||||||||   |||||||  || |||||| |||| u
cg     ugu ac uccaaggacgagU   UGGUACC  CA ACUCGU Uguu g
  ucauc   u  u             CUU       -C  U      C    c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 152393421-152393529 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-767
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-767 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-767-5p

Accession MIMAT0003882
Description Homo sapiens hsa-miR-767-5p mature miRNA
Sequence 27 - UGCACCAUGGUUGUCUGAGCAUG - 49
Evidence experimental
cloned [1]
Database links
Predicted targets

Mature hsa-miR-767-3p

Accession MIMAT0003883
Description Homo sapiens hsa-miR-767-3p mature miRNA
Sequence 61 - UCUGCUCAUACCCCAUGGUUUCU - 83
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298