MIR449C is a microRNA that has been found to be upregulated upon air exposure in an AhR-dependent manner [PMC4999520]. It is part of a hyper-conserved region that includes the miR34a/b/c, MIR449C, and let-7a miRNA seed sequence regions [PMC6576772]. MIR449C is highly homologous to miR449a and miR449b [PMC6412851]. Increased expression of MIR449C has been associated with the generation of mo-MDSCs, and it plays a role in regulating brain development, motile ciliogenesis, and spermatogenesis [PMC7528684]. In liver cancer, MIR449C acts as a tumor suppressor by promoting cell death and inhibiting cell migration [PMC7528684]. Overexpression of MIR449C leads to the expansion of mo-MDSCs, while knockdown inhibits differentiation of myeloid progenitor cells to mo-MDSCs [PMC7528684]. STAT6 has been identified as a downstream target and functional mediator of MIR449C during myeloid progenitor cell differentiation [PMC7528684]. Additionally, MIR449C has been identified as an important regulator of proliferation and invasion in nonsmall cell lung cancer and gastric cancer [PMC7528684]. It is part of the isomiR families that show altered expression in various conditions such as miR125a/b, miR10a/b, miR92a/b, and miR99a [PMC8705090]. In Emca3 gene region there are several genes that encode small RNAs including miR449a, MIR449C, and miR582 [PMC4132170].
--g gu U C UU u gcu ggaugu cagg AGG AGUGUA GCUAGCGGCUGUuaa g ||| |||||| |||| ||| |||||| ||||||||||||||| a cga cuuacg GUCU UCC UCACGU UGAUCGUUgacaauu u aga uU C - -- u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0010251 |
Description | Homo sapiens hsa-miR-449c-5p mature miRNA |
Sequence | 17 - UAGGCAGUGUAUUGCUAGCGGCUGU - 41 |
Evidence |
experimental
RAKE [1], 454 [2] |
Database links | |
Predicted targets |
Accession | MIMAT0013771 |
Description | Homo sapiens hsa-miR-449c-3p mature miRNA |
Sequence | 57 - UUGCUAGUUGCACUCCUCUCUGU - 79 |
Evidence |
experimental
454 [2] |
|