![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-802 |
|||||
Accession | MI0004249 (change log) | ||||
Symbol | MGI:Mir802 | ||||
Description | Mus musculus miR-802 stem-loop | ||||
Gene family | MIPF0000353; mir-802 | ||||
Literature search |
![]()
20 open access papers mention mmu-mir-802 | ||||
Stem-loop |
------ uc u auc a a --- c 5' gg cuauua uugca agu acaaagauuc ucc uugugu a || |||||| ||||| ||| |||||||||| ||| |||||| a 3' cc gauaau aaugu uca uguuucugag agg aacaua u ccacuu -- u gac c - cac c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-802-5p |
|
Accession | MIMAT0004188 |
Previous IDs | mmu-miR-802 |
Sequence |
18 - ucaguaacaaagauucauccuu - 39 |
Deep sequencing | 1462 reads, 28 experiments |
Evidence | experimental; miRAP-cloned [1], cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-802-3p |
|
Accession | MIMAT0017240 |
Previous IDs | mmu-miR-802* |
Sequence |
56 - acggagagucuuugucacucag - 77 |
Deep sequencing | 1840 reads, 23 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|