![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3099 |
|||||
Accession | MI0004485 (change log) | ||||
Symbol | MGI:Mir3099 | ||||
Description | Mus musculus miR-3099 stem-loop | ||||
Gene family | MIPF0001559; mir-3099 | ||||
Literature search |
![]()
5 open access papers mention mmu-mir-3099 | ||||
Stem-loop |
ga - c c cu a uuu 5' auc uccccauccc agcuuc uuc agcc ug ugu a ||| |||||||||| |||||| ||| |||| || ||| 3' uag agggguaggg uuggag gag ucgg ac acg g aa g a a au - cau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-3099-5p |
|
Accession | MIMAT0014815 |
Previous IDs | mmu-miR-3099* |
Sequence |
14 - ccagcuuccuuccagcccuug - 34 |
Deep sequencing | 9 reads, 7 experiments |
Evidence | experimental; Illumina [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-3099-3p |
|
Accession | MIMAT0014816 |
Previous IDs | mmu-miR-3099 |
Sequence |
52 - uaggcuagagagagguugggga - 73 |
Deep sequencing | 30243 reads, 51 experiments |
Evidence | experimental; Illumina [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|