Stem-loop mmu-mir-760

Accession

MI0004605

Symbol

MGI: Mir760

Description

Mus musculus mmu-mir-760 precursor miRNA

Gene family

MIPF0000395; mir-760

Literature search

6 open access papers mention mmu-mir-760
(126 sentences)

Sequence

9543 reads, 126 reads per million, 86 experiments

cgggaggaugccucggugcggggcgcgucgccCCCCUCAGGCCACCAGAGCCCGGauaccucagaaauuCGGCUCUGGGUCUGUGGGGAgcgaaaugcaacccaaaccccguuuccccg
((((.(((((....(((..(((..(((((((.((((.((((((..(((((((.((((.........))))))))))))))))).)))).))))..)))..)))..))).))))).))))

Structure

    a     ccuc   gc   gc   --    c    U      AC       C    acc 
cggg ggaug    ggu  ggg  gcg  ucgc CCCC CAGGCC  CAGAGCC GGau   u
|||| |||||    |||  |||  |||  |||| |||| ||||||  ||||||| ||||   c
gccc uuugc    cca  ccc  cgu  agcg GGGG GUCUGG  GUCUCGG Cuua   a
    c     ---c   aa   aa   aa    A    U      --       -    aag 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr3: 122293585-122293703 [-]

Mature mmu-miR-760-5p

• Accession: MIMAT0017245
• Description: Mus musculus mmu-miR-760-5p mature miRNA
• Sequence: 33 - CCCCUCAGGCCACCAGAGCCCGG - 55
• Evidence: experimental ; Illumina [4]

Mature mmu-miR-760-3p

• Accession: MIMAT0003898
• Description: Mus musculus mmu-miR-760-3p mature miRNA
• Sequence: 70 - CGGCUCUGGGUCUGUGGGGA - 89
• Evidence: experimental ; cloned [1-2], RAKE [1], Illumina [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298