![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-344d-2 |
||||||
Accession | MI0004619 (change log) | |||||
Symbol | MGI:Mir344d-2 | |||||
Description | Mus musculus miR-344d-2 stem-loop | |||||
Gene family | MIPF0000267; mir-344 | |||||
Literature search |
![]()
10 open access papers mention mmu-mir-344d-2 | |||||
Stem-loop |
agauu - u c c u u 5' ucau uagucuggu g ugg uauau ccaggacu a |||| ||||||||| | ||| ||||| |||||||| u 3' ggua gucagaccg c acc auaua gguccugg c --cgu a u - a - u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-344d-2-5p |
|
Accession | MIMAT0014961 |
Previous IDs | mmu-miR-344d-2* |
Sequence |
11 - agucugguugcuggcuauauucca - 34 |
Deep sequencing | 5 reads, 4 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mmu-miR-344d-3p |
|
Accession | MIMAT0014808 |
Previous IDs | mmu-miR-344d |
Sequence |
52 - gauauaaccacugccagacuga - 73 |
Deep sequencing | 33184 reads, 47 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|