Stem-loop sequence mmu-mir-693

AccessionMI0004662 (change log)
Symbol MGI:Mir693
DescriptionMus musculus miR-693 stem-loop
Literature search

1 open access papers mention mmu-mir-693
(1 sentences)

Stem-loop
   a    ua                       c       u    g 
5'  guug  ggcaugcucauuacagccacauc gaaaguu uccu g
    ||||  ||||||||||||||||||||||| ||||||| ||||  
3'  cgac  ucguacgaguaaugucgguguag cuuucga ggga c
   -    cc                       a       c    u 
Get sequence
Deep sequencing
82 reads, 13.9 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 46231531-46231619 [+]
sense
ENSMUST00000087031 ; Xpo5-201; intron 20
Database links

Mature sequence mmu-miR-693-5p

Accession MIMAT0003472
Previous IDsmmu-miR-693
Sequence

21 - 

cagccacauccgaaaguuuuc

 - 41

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; MPSS [1]
Predicted targets

Mature sequence mmu-miR-693-3p

Accession MIMAT0004189
Sequence

51 - 

gcagcuuucagauguggcuguaa

 - 73

Get sequence
Deep sequencing76 reads, 33 experiments
Evidence experimental; miRAP-cloned [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).