Stem-loop sequence dre-mir-723

AccessionMI0004767 (change log)
DescriptionDanio rerio miR-723 stem-loop
Gene family MIPF0001831; mir-723
Stem-loop
   u  --          ag    u     a       acu       a 
5'  gc  guagagauaa  acag uuuaa ugauguu   uuuuuuc a
    ||  ||||||||||  |||| ||||| |||||||   |||||||  
3'  cg  caucucuauu  uguc aaauu acuacag   aaagagg a
   a  aa          cg    u     a       ---       u 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
KN149706.1: 28026-28114 [-]
intergenic
Database links

Mature sequence dre-miR-723-5p

Accession MIMAT0003750
Previous IDsdre-miR-723*
Sequence

15 - 

gacaguuuuaaaugauguuacuuu

 - 38

Get sequence
Evidence experimental; cloned [1], Northern [1]

Mature sequence dre-miR-723-3p

Accession MIMAT0003751
Previous IDsdre-miR-723
Sequence

53 - 

aagacaucaauuaaaucugugcu

 - 75

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; cloned [1], Northern [1]
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).