Stem-loop sequence dre-mir-727

AccessionMI0004771 (change log)
DescriptionDanio rerio miR-727 stem-loop
Gene family MIPF0001371; mir-727
Literature search

1 open access papers mention dre-mir-727
(2 sentences)

Stem-loop
          u      c            cu  -    ccg   ccau 
5' cuguaug cauuuu agucuucaauuc  cc cagc   uac    c
   ||||||| |||||| ||||||||||||  || ||||   |||    g
3' gacaugu gugaaa ucagaaguugag  gg guug   gug    a
          c      u            -c  a    --a   ucaa 
Get sequence
Deep sequencing
333 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 26185410-26185500 [+]
sense
OTTDART00000044624 ; tmtopsb-001; intron 3
ENSDART00000139017 ; tmtopsb-001; intron 3
ENSDART00000038824 ; tmtopsb-201; intron 3
Clustered miRNAs
< 10kb from dre-mir-727
dre-mir-727chr24: 26185410-26185500 [+]
dre-mir-728chr24: 26190552-26190634 [+]
Database links

Mature sequence dre-miR-727-5p

Accession MIMAT0003755
Previous IDsdre-miR-727*
Sequence

14 - 

ucagucuucaauuccucccagc

 - 35

Get sequence
Deep sequencing8 reads, 5 experiments
Evidence experimental; cloned [1], Northern [1]

Mature sequence dre-miR-727-3p

Accession MIMAT0003756
Previous IDsdre-miR-727
Sequence

57 - 

guugaggcgaguugaagacuua

 - 78

Get sequence
Deep sequencing325 reads, 10 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).