Stem-loop sequence dre-mir-728

AccessionMI0004772 (change log)
DescriptionDanio rerio miR-728 stem-loop
Gene family MIPF0001670; mir-728
Stem-loop
        uc              ag   aua       a  gaa 
5' caucu  ugaggaaauguagu  acu   aguauac gu   c
   |||||  ||||||||||||||  |||   ||||||| ||    
3' gugga  acucuuuugcauca  uga   ucauaug ca   a
        ga              ca   --a       -  agu 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 26190552-26190634 [+]
sense
OTTDART00000044624 ; tmtopsb-001; intron 3
ENSDART00000139017 ; tmtopsb-001; intron 3
ENSDART00000038824 ; tmtopsb-201; intron 3
Clustered miRNAs
< 10kb from dre-mir-728
dre-mir-727chr24: 26185410-26185500 [+]
dre-mir-728chr24: 26190552-26190634 [+]
Database links

Mature sequence dre-miR-728

Accession MIMAT0003757
Sequence

52 - 

auacuaaguacacuacguuuuc

 - 73

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).