Stem-loop sequence dre-mir-729

AccessionMI0004773 (change log)
DescriptionDanio rerio miR-729 stem-loop
Gene family MIPF0001307; mir-729
Stem-loop
       aagg     c a          g      ug  a   a  uguaagu 
5' cguc    gccau c gugacccggg uuguau  ua cca gc       g
   ||||    ||||| | |||||||||| ||||||  || ||| ||        
3' guag    uggua g cauugggucc agcaua  au ggu cg       u
       ----     a a          -      gu  g   a  uaguacc 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 13584483-13584581 [+]
intergenic
Database links

Mature sequence dre-miR-729

Accession MIMAT0003758
Sequence

62 - 

cauggguaugauacgaccuggguu

 - 85

Get sequence
Deep sequencing58 reads, 8 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).