Stem-loop sequence dre-mir-730

AccessionMI0004775 (change log)
DescriptionDanio rerio miR-730 stem-loop
Gene family MIPF0000134; mir-460
Stem-loop
           cg      u       ca       -u u  uc 
5' ggguucuc  gucucc cauugug  ugcugug  g cu  a
   ||||||||  |||||| |||||||  |||||||  | ||  g
3' cucagggg  cggagg guaacgu  gcgacac  c gg  u
           au      u       cc       uc u  uc 
Get sequence
Deep sequencing
325 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 23362162-23362245 [+]
sense
OTTDART00000039577 ; htr2cl1-001; intron 1
ENSDART00000134489 ; htr2cl1-001; intron 1
KZ114890.1: 126326-126409 [+]
sense
OTTDART00000039577 ; htr2cl1-001; intron 1
ENSDART00000134489 ; htr2cl1-001; intron 1
KZ115225.1: 429492-429575 [+]
sense
OTTDART00000039577 ; htr2cl1-001; intron 1
ENSDART00000134489 ; htr2cl1-001; intron 1
Database links

Mature sequence dre-miR-730

Accession MIMAT0003760
Sequence

14 - 

uccucauugugcaugcugugugu

 - 36

Get sequence
Deep sequencing249 reads, 11 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).