Stem-loop sequence dre-mir-732

AccessionMI0004777 (change log)
DescriptionDanio rerio miR-732 stem-loop
Stem-loop
        aag              aaa       gu   uuaa 
5' agaua   uuccaccgaggguu   uguuuug  auu    u
   |||||   ||||||||||||||   |||||||  |||    a
3' uuuau   gagguggcucucaa   acgaaac  uaa    g
        gua              gag       uc   cugu 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 41682926-41683010 [+]
intergenic
Database links

Mature sequence dre-miR-732

Accession MIMAT0003762
Sequence

52 - 

cucaaagcagagaacucucggu

 - 73

Get sequence
Deep sequencing55 reads, 10 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).