Stem-loop sequence dre-mir-737

AccessionMI0004783 (change log)
DescriptionDanio rerio miR-737 stem-loop
Gene family MIPF0001689; mir-737
Literature search

1 open access papers mention dre-mir-737
(1 sentences)

Stem-loop
      cag   -      u  ug                     ---g   a 
5' cca   cug cugugc gu  uuuuuuuagguuuugauuuuu    uga a
   |||   ||| |||||| ||  |||||||||||||||||||||    |||  
3' ggu   gau gacgcg ca  aaagaaauccaaaacuaaaag    gcu u
      --a   a      u  ua                     agua   g 
Get sequence
Deep sequencing
3749 reads, 164 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr18: 45962897-45962992 [+]
sense
OTTDART00000045368 ; ap2m1b-001; intron 3
OTTDART00000053094 ; ap2m1b-002; intron 3
ENSDART00000151418 ; ap2m1b-001; intron 3
ENSDART00000151112 ; ap2m1b-002; intron 3
ENSDART00000124051 ; ap2m1b-202; intron 3
ENSDART00000108636 ; ap2m1b-201; intron 3
Database links

Mature sequence dre-miR-737-5p

Accession MIMAT0032013
Sequence

20 - 

guuuuuuuagguuuugauuuu

 - 40

Get sequence
Deep sequencing3622 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-737-3p

Accession MIMAT0003768
Previous IDsdre-miR-737
Sequence

60 - 

aaucaaaaccuaaagaaaaua

 - 80

Get sequence
Deep sequencing70 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).