Stem-loop sequence dre-mir-740

AccessionMI0004786 (change log)
DescriptionDanio rerio miR-740 stem-loop
Literature search

1 open access papers mention dre-mir-740
(1 sentences)

Stem-loop 
     a    u    -   aaaa               u        -   acu    ga 
5' gc uuug gugc aua    gugguaugguacagu ugcuuuua ggu   uuuu  c
   || |||| |||| |||    ||||||||||||||| |||||||| |||   ||||   
3' cg ggac caug uau    uaccaugccauguca gcgaaaau ccg   aagg  a
     g    -    g   gcca               u        a   acu    ug
Get sequence
Deep sequencing
9 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 30165953-30166065 [+]
sense
OTTDART00000046791 ; vps8-004; intron 4
OTTDART00000046793 ; vps8-001; intron 8
OTTDART00000046792 ; vps8-003; intron 23
ENSDART00000134311 ; vps8-004; intron 4
ENSDART00000101779 ; vps8-001; intron 8
ENSDART00000041419 ; vps8-201; intron 8
ENSDART00000143639 ; vps8-003; intron 23
KZ115028.1: 50406-50518 [+]
sense
OTTDART00000046791 ; vps8-004; intron 4
OTTDART00000046793 ; vps8-001; intron 8
OTTDART00000046792 ; vps8-003; intron 23
ENSDART00000134311 ; vps8-004; intron 4
ENSDART00000101779 ; vps8-001; intron 8
ENSDART00000041419 ; vps8-201; intron 8
ENSDART00000143639 ; vps8-003; intron 23
Database links

Mature sequence dre-miR-740

Accession MIMAT0003771
Sequence

13 -  

auaaaaagugguaugguacagu

 - 34

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).