![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ebv-mir-BART17 |
||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0004990 (change log) | |||||||||||||||||||||||||||||||||||||||||||
Description | Epstein Barr virus miR-BART17 stem-loop | |||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000321; mir-BART17 | |||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
aac -a gca - a - uuauu 5' guug agg ugug cc cuaag ggacgc aggcauacaagg a |||| ||| |||| || ||||| |||||| |||||||||||| 3' cgau ucc acgc gg gauuc ccugug uccguauguucc c gga gg -ag u c g ugacc |
|||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||
Comments |
The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART8 by Grundhoff et al [1] but is not related to ebv-miR-BART8 (MI0003730). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence ebv-miR-BART17-5p |
|
Accession | MIMAT0003715 |
Sequence |
22 - uaagaggacgcaggcauacaag - 43 |
Evidence | experimental; array [1], Northern [1], cloned [2] |
Mature sequence ebv-miR-BART17-3p |
|
Accession | MIMAT0003716 |
Sequence |
60 - uguaugccugguguccccuuagu - 82 |
Evidence | experimental; array [1], Northern [1], cloned [2] |
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|