Stem-loop sequence ebv-mir-BART17

AccessionMI0004990 (change log)
DescriptionEpstein Barr virus miR-BART17 stem-loop
Gene family MIPF0000321; mir-BART17
Stem-loop 
       aac   -a    gca  -     a      -            uuauu 
5' guug   agg  ugug   cc cuaag ggacgc aggcauacaagg     a
   ||||   |||  ||||   || ||||| |||||| ||||||||||||      
3' cgau   ucc  acgc   gg gauuc ccugug uccguauguucc     c
       gga   gg    -ag  u     c      g            ugacc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART8 by Grundhoff et al [1] but is not related to ebv-miR-BART8 (MI0003730). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 139894-139995 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART17
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
Database links

Mature sequence ebv-miR-BART17-5p

Accession MIMAT0003715
Sequence

22 -  

uaagaggacgcaggcauacaag

 - 43

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

Mature sequence ebv-miR-BART17-3p

Accession MIMAT0003716
Sequence

60 -  

uguaugccugguguccccuuagu

 - 82

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

References

1
PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).