Stem-loop sequence ebv-mir-BART19

AccessionMI0004992 (change log)
DescriptionEpstein Barr virus miR-BART19 stem-loop
Gene family MIPF0000983; mir-BART19
Stem-loop
     a    u       caa       -c       u      gg ua 
5' gu uccg guccuga   cauuccc  gcaaaca gacaug  u  a
   || |||| |||||||   |||||||  ||||||| ||||||  |   
3' cg aggu cgggauu   guaaggg  cguuugu uuguac  a  u
     a    c       cuc       uu       u      aa uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART17 by Grundhoff et al [1]. The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 148198-148290 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART19
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART19-5p

Accession MIMAT0004836
Sequence

18 - 

acauuccccgcaaacaugacaug

 - 40

Get sequence
Evidence experimental; cloned [2]

Mature sequence ebv-miR-BART19-3p

Accession MIMAT0003718
Previous IDsebv-miR-BART19
Sequence

57 - 

uuuuguuugcuugggaaugcu

 - 77

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).