Stem-loop sequence mmu-mir-615

Accession

MI0005004 (change log)

Symbol

MGI:Mir615

Description

Mus musculus miR-615 stem-loop

Gene family

MIPF0000342; mir-615

Literature search

11 open access papers mention mmu-mir-615
(153 sentences)

Stem-loop

   uc    -    c          uc     u        cu    g ug 
5'   ggga gggg gggagggggg  cccgg gcucggau  cgag g  c
     |||| |||| ||||||||||  ||||| ||||||||  |||| |  u
3'   cccu cccc ccuucucccu  ggguc cgagccug  gcuu u  u
   --    a    -          cu     -        --    g ua 

Deep sequencing

16542 reads, 87.5 reads per million, 72 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr15: 103014910-103015001 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000096497 ; Hoxc5-002; intron 1

  OTTMUST00000096505 ; Hoxc5-001; intron 1

  ENSMUST00000174869 ; Hoxc5-002; intron 1

  ENSMUST00000001709 ; Hoxc5-001; intron 1

Database links

• EntrezGene:Mir615
• MGI:Mir615
• RNAcentral:URS0000759AB4_10090
• miRBase Tracker:MI0005004

Mature sequence mmu-miR-615-5p

• Accession: MIMAT0004837
• Sequence: 17 - ggggguccccggugcucggauc - 38
• Deep sequencing: 927 reads, 37 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00004D8280_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-615-5p
  • miRDB:mmu-miR-615-5p
  • microrna.org:mmu-miR-615-5p

Mature sequence mmu-miR-615-3p

• Accession: MIMAT0003783
• Previous IDs: mmu-miR-615
• Sequence: 60 - uccgagccugggucucccucuu - 81
• Deep sequencing: 15524 reads, 60 experiments
• Evidence: experimental; MPSS [1], cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003D5391_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-615-3p
  • miRDB:mmu-miR-615-3p
  • microrna.org:mmu-miR-615-3p

References

1. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).