![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-615 |
|||||
Accession | MI0005004 (change log) | ||||
Symbol | MGI:Mir615 | ||||
Description | Mus musculus miR-615 stem-loop | ||||
Gene family | MIPF0000342; mir-615 | ||||
Literature search |
![]()
11 open access papers mention mmu-mir-615 | ||||
Stem-loop |
uc - c uc u cu g ug 5' ggga gggg gggagggggg cccgg gcucggau cgag g c |||| |||| |||||||||| ||||| |||||||| |||| | u 3' cccu cccc ccuucucccu ggguc cgagccug gcuu u u -- a - cu - -- g ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-615-5p |
|
Accession | MIMAT0004837 |
Sequence |
17 - ggggguccccggugcucggauc - 38 |
Deep sequencing | 927 reads, 37 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-615-3p |
|
Accession | MIMAT0003783 |
Previous IDs | mmu-miR-615 |
Sequence |
60 - uccgagccugggucucccucuu - 81 |
Deep sequencing | 15524 reads, 60 experiments |
Evidence | experimental; MPSS [1], cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|