Stem-loop sequence bta-mir-29c

AccessionMI0005044 (change log)
DescriptionBos taurus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

31 open access papers mention bta-mir-29c
(95 sentences)

Stem-loop 
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u
Get sequence
Deep sequencing
165384 reads, 1.02e+03 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 77733161-77733248 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-29c
bta-mir-29b-2chr16: 77732601-77732681 [+]
bta-mir-29cchr16: 77733161-77733248 [+]
Database links

Mature sequence bta-miR-29c

Accession MIMAT0003829
Sequence

54 -  

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing164877 reads, 76 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).