![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-29c |
||||||
Accession | MI0005044 (change log) | |||||
Description | Bos taurus miR-29c stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Literature search |
![]()
31 open access papers mention bta-mir-29c | |||||
Stem-loop |
a - ggc ucc --- u 5' ucucuuaca ca ugaccgauuuc ugguguu cagag c ||||||||| || ||||||||||| ||||||| ||||| u 3' gggggaugu gu auuggcuaaag accacga guuuu g a a --- uuu ucu u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-29c |
|
Accession | MIMAT0003829 |
Sequence |
54 - uagcaccauuugaaaucgguua - 75 |
Deep sequencing | 164877 reads, 76 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|