Stem-loop sequence osa-MIR395m

Accession

MI0005084 (change log)

Description

Oryza sativa miR395m stem-loop

Gene family

MIPF0000016; MIR395

Literature search

39 open access papers mention osa-MIR395m
(170 sentences)

Stem-loop

            u    u       g  --g          --a        u  a     cu   a 
5' gaguucucc caaa cacuuca ua   auagcuagcu   ggcuucau gc uuaca  guu c
   ||||||||| |||| ||||||| ||   ||||||||||   |||||||| || |||||  |||  
3' cucaagggg guuu gugaagu au   uguugaucga   ccggggua cg agugu  caa a
            -    -       g  aua          aaa        -  -     --   a 

Deep sequencing

25 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1].

Genome context

• Coordinates (MSU7): Chr4: 32621993-32622112 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR395m

• osa-MIR395m: Chr4: 32621993-32622112 [+]
• osa-MIR395n: Chr4: 32622243-32622308 [+]
• osa-MIR395o: Chr4: 32622381-32622449 [+]
• osa-MIR395p: Chr4: 32622525-32622592 [+]
• osa-MIR395q: Chr4: 32622668-32622735 [+]
• osa-MIR395r: Chr4: 32622811-32622878 [+]
• osa-MIR395s: Chr4: 32622943-32623028 [+]
• osa-MIR395x: Chr4: 32623067-32623162 [+]

Database links

• miRBase Tracker:MI0005084

Mature sequence osa-miR395m

• Accession: MIMAT0003870
• Sequence: 100 - gugaaguguuugggggaacuc - 120
• Deep sequencing: 25 reads, 2 experiments
• Evidence: by similarity; MI0001007
• Database links:
  • RNAcentral:URS000034BBE9_39947

References

1. PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).