miRBase
|
|
miRBase |
|
|
||
Stem-loop sequence osa-MIR395v |
||||||||||
| Accession | MI0005090 (change log) | |||||||||
| Description | Oryza sativa miR395v stem-loop | |||||||||
| Gene family | MIPF0000016; MIR395 | |||||||||
| Literature search |
![](javascript:TINY.box.show( {html:'<img style="padding:20px;" width=460 src="/images/wordcloud/00/05/09/MI0005090.png">', width:500,height:500, mask:true, opacity:5, close:true} ))
39 open access papers mention osa-MIR395v | |||||||||
| Stem-loop |
a cu c - a aauu 5' ga uucu uuaag acuucaua cgac c a || |||| ||||| |||||||| |||| | u 3' cu aagg gguuu ugaagugu guug g u c -c a u g aacu |
|||||||||
| Deep sequencing |
| |||||||||
| Confidence |
Annotation confidence: not enough data
| |||||||||
| Comments |
Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1]. |
|||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links |
|
|||||||||
Mature sequence osa-miR395v |
|
| Accession | MIMAT0003876 |
| Sequence |
49 - gugaaguauuuggcggaacuc - 69 |
| Deep sequencing | 5 reads, 2 experiments |
| Evidence | by similarity; MI0001007 |
References |
|
| 1 |
PMID:16117853
"Molecular evolution of the rice miR395 gene family"
Cell Res. 15:631-638(2005).
|