Stem-loop osa-MIR815b

Accession

MI0005243

Description

Oryza sativa osa-MIR815b precursor miRNA

Gene family

MIPF0000349; MIR815

Literature search

2 open access papers mention osa-MIR815b
(2 sentences)

Sequence

1507 reads, 1061 reads per million, 2 experiments

cuaaugguucaccucguuuugcguauauucccaaucuucucuauuuccuucuccucaaacacagccugggaguguuugagAAGGGGAUUGAGGAGAUUGGGaagauacguaaaacgaggugagccauuag
((((((((((((((((((((((((((.((((((((((((((.(((((((((((...((((((.........))))))))))))))))).)))))))))))))).))))))))))))))))))))))))))

Structure

                          a              u           cuc      agc 
cuaaugguucaccucguuuugcguau uucccaaucuucuc auuuccuucuc   aaacac   c
|||||||||||||||||||||||||| |||||||||||||| |||||||||||   ||||||   u
gauuaccgaguggagcaaaaugcaua aaGGGUUAGAGGAG UAGGGGAAgag   uuugug   g
                          g              U           ---      agg 

Annotation confidence Low

Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context

Chr5: 14992226-14992355 [+]

Mature osa-miR815b

• Accession: MIMAT0004059
• Description: Oryza sativa osa-miR815b mature miRNA
• Sequence: 81 - AAGGGGAUUGAGGAGAUUGGG - 101
• Evidence: experimental ; cloned [1], Northern [1]

References

1. PubMed ID: 16959252
   Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development
   "Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH"
   "FEBS Lett (2006) 580:5111-5116