Stem-loop sequence osa-MIR817

AccessionMI0005246 (change log)
DescriptionOryza sativa miR817 stem-loop
Stem-loop
             a             u              a 
5' uaucucaauc ggccucaaguugg guccgucauggaug u
   |||||||||| ||||||||||||| |||||||||||||| g
3' auagaguuag ccggaguucaacc cgggcagugccuac g
             c             u              u 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR817 was misnamed miR578 by Luo et al [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 12276365-12276447 [-]
intergenic
Database links

Mature sequence osa-miR817

Accession MIMAT0004062
Sequence

59 - 

uccaacuugaggcccgauuga

 - 79

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]

References

1