Stem-loop sequence mdo-mir-204

AccessionMI0005316 (change log)
DescriptionMonodelphis domestica miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop 
   caacu   uaugu   cug     u         ca    a     g aaa 
5'      gac     gac   ugggc ucccuuugu  uccu ugccu g   u
        |||     |||   ||||| |||||||||  |||| ||||| |   c
3'      cug     cug   acucg agggaaacg  aggg acggg u   a
   --cuu   -----   ucg     u         ac    -     g gag
Get sequence
Deep sequencing
4262 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 142496646-142496742 [-]
sense
ENSMODT00000036580 ; TRPM1-201; intron 3
Database links

Mature sequence mdo-miR-204

Accession MIMAT0004127
Sequence

25 -  

uucccuuugucauccuaugccu

 - 46

Get sequence
Deep sequencing4257 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).