Stem-loop sequence mdo-mir-208a

Accession

MI0005318 (change log)

Description

Monodelphis domestica miR-208a stem-loop

Gene family

MIPF0000178; mir-208

Stem-loop

   uuccugu   ag          g uc  gg      - uga 
5'        gac  gugagcuuuu g  cg  uuauac c   u
          |||  |||||||||| |  ||  |||||| |    
3'        cug  ugcucgaaaa c  gc  aauaug g   g
   ------g   gu          a ga  ag      u uac 

Deep sequencing

199 reads, 0 reads per million, 1 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MonDom5; GCF_000002295.2): chr1: 172794234-172794310 [-]
• Overlapping transcripts:

  sense

  ENSMODT00000005567 ; MYH7-201; intron 34

Database links

• EntrezGene:Mir208
• miRBase Tracker:MI0005318

Mature sequence mdo-miR-208a

• Accession: MIMAT0004129
• Sequence: 50 - auaagacgagcaaaaagcucgu - 71
• Deep sequencing: 199 reads, 1 experiments
• Evidence: by similarity; MI0000555
• Predicted targets:
  • TargetScanVert:mdo-miR-208a

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).