Stem-loop sequence mdo-mir-208a

AccessionMI0005318 (change log)
DescriptionMonodelphis domestica miR-208a stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
   uuccugu   ag          g uc  gg      - uga 
5'        gac  gugagcuuuu g  cg  uuauac c   u
          |||  |||||||||| |  ||  |||||| |    
3'        cug  ugcucgaaaa c  gc  aauaug g   g
   ------g   gu          a ga  ag      u uac 
Get sequence
Deep sequencing
199 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 172794234-172794310 [-]
sense
ENSMODT00000005567 ; MYH7-201; intron 34
Database links

Mature sequence mdo-miR-208a

Accession MIMAT0004129
Sequence

50 - 

auaagacgagcaaaaagcucgu

 - 71

Get sequence
Deep sequencing199 reads, 1 experiments
Evidence by similarity; MI0000555
Predicted targets

References

1