Stem-loop sequence mdo-mir-375

AccessionMI0005327 (change log)
DescriptionMonodelphis domestica miR-375 stem-loop
Gene family MIPF0000114; mir-375
Stem-loop
   -  -     c     ccu  c     c  gac 
5'  cc cgcgc gagcc   cg acaaa cg   c
    || ||||| |||||   || ||||| ||    
3'  gg gugcg cucgg   gc uguuu gc   u
   c  a     -     cuu  u     u  gag 
Get sequence
Deep sequencing
3931 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr7: 173725890-173725952 [+]
intergenic
Database links

Mature sequence mdo-miR-375

Accession MIMAT0004138
Sequence

38 - 

uuuuguucguucggcucgcguga

 - 60

Get sequence
Deep sequencing3931 reads, 5 experiments
Evidence by similarity; MI0000792
Predicted targets

References

1