![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdo-mir-18a |
||||||||||||||
Accession | MI0005355 (change log) | |||||||||||||
Description | Monodelphis domestica miR-18a stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Stem-loop |
u cu u uc u a - aa u 5' uguu aagg gca uag gcag uag ug g a |||| |||| ||| ||| |||| ||| || | g 3' acgg uucc cgu auc cguc auc ac u a - uc u ga c - u ga u |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence mdo-miR-18a-5p |
|
Accession | MIMAT0004167 |
Sequence |
7 - uaaggugcaucuagugcagaua - 28 |
Deep sequencing | 4371 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mdo-miR-18a-3p |
|
Accession | MIMAT0026705 |
Sequence |
48 - acugcccuaagugcuccuucuggc - 71 |
Deep sequencing | 98 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|