Stem-loop sequence mdo-mir-18a

Accession

MI0005355 (change log)

Description

Monodelphis domestica miR-18a stem-loop

Gene family

MIPF0000001; mir-17

Stem-loop

   u    cu    u   uc   u    a   -  aa u 
5'  uguu  aagg gca  uag gcag uag ug  g a
    ||||  |||| |||  ||| |||| ||| ||  | g
3'  acgg  uucc cgu  auc cguc auc ac  u a
   -    uc    u   ga   c    -   u  ga u 

Deep sequencing

4471 reads, 40 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MonDom5; GCF_000002295.2): chr7: 108468760-108468831 [-]
• Overlapping transcripts:

  sense

  ENSMODT00000028266 ; mdo-mir-18a-201; exon 1

Clustered miRNAs

< 10kb from mdo-mir-18a

• mdo-mir-17: chr7: 108468894-108468978 [-]
• mdo-mir-18a: chr7: 108468760-108468831 [-]
• mdo-mir-19a: chr7: 108468609-108468689 [-]
• mdo-mir-20a: chr7: 108468430-108468531 [-]
• mdo-mir-19b-1: chr7: 108468305-108468393 [-]
• mdo-mir-92a-1: chr7: 108468191-108468268 [-]

Database links

• EntrezGene:Mir18
• miRBase Tracker:MI0005355

Mature sequence mdo-miR-18a-5p

• Accession: MIMAT0004167
• Sequence: 7 - uaaggugcaucuagugcagaua - 28
• Deep sequencing: 4371 reads, 5 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mdo-miR-18a-5p

Mature sequence mdo-miR-18a-3p

• Accession: MIMAT0026705
• Sequence: 48 - acugcccuaagugcuccuucuggc - 71
• Deep sequencing: 98 reads, 5 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetScanVert:mdo-miR-18a-3p

References

1. PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).