WARNING: This summary was generated by AI. Bta-let-7c is a member of the let-7 family of microRNAs, which are small, non-coding RNA molecules involved in the regulation of gene expression [PMC5999645]. This microRNA was found to be significantly upregulated in placental exosomes compared to non-pregnant exosomes, indicating a potential role in pregnancy [PMC5999645]. Bta-let-7c expression was also significantly altered by exosome treatment, suggesting its involvement in cellular communication [PMC5999645]. Furthermore, bta-let-7c has been implicated in the regulation of inflammatory responses as its overexpression can decrease the expression of proinflammatory cytokines and NRAS [PMC5999645]. It has been observed to be upregulated following LPS challenge in bubaline PBMCs and mice whole blood, which may indicate a role in immune responses [PMC4892552]. Bta-let-7c is also among the most abundant miRNAs across various developmental stages and is considered an important nutritional component of milk across different species [PMC7073773; PMC7191744].. It may regulate glycerophospholipid metabolism by inhibiting enzymes involved in triglyceride synthesis and degradation [PMC5341059]. Despite its emerging significance, further research is needed to fully understand bta-let-7c's role during bovine mastitis and other conditions affecting cattle health [PMC7937231].
a uU G U ua g ua c gc uccggg GAG UAG AGGUUGUAUGGUU ga u ca || |||||| ||| ||| ||||||||||||| || | || c cg agguuC UUC AUC UCCAACAUGUCaa uu a gu - CU G U -- g gg c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0004332 |
| Description | Bos taurus bta-let-7c-5p mature miRNA |
| Sequence | 11 - UGAGGUAGUAGGUUGUAUGGUU - 32 |
| Evidence |
experimental
cloned [1] |
| Accession | MIMAT0060915 |
| Description | Bos taurus bta-let-7c-3p mature miRNA |
| Sequence | 56 - CUGUACAACCUUCUAGCUUUCC - 77 |
| Evidence |
experimental
Illumina [1] |
|