![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-190b |
|||||
Accession | MI0005478 (change log) | ||||
Symbol | MGI:Mir190b | ||||
Description | Mus musculus miR-190b stem-loop | ||||
Gene family | MIPF0000076; mir-190 | ||||
Literature search |
![]()
22 open access papers mention mmu-mir-190b | ||||
Stem-loop |
-- u u - g - aaa 5' ugcu cugug ga uauguuugauauu gguug uu u |||| ||||| || ||||||||||||| ||||| || 3' auga gacac cu auacgaacuguaa ucaac aa u ga c u c g c gua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-190b-5p |
|
Accession | MIMAT0004852 |
Previous IDs | mmu-miR-190b |
Sequence |
11 - ugauauguuugauauuggguug - 32 |
Deep sequencing | 2493 reads, 97 experiments |
Evidence | experimental; cloned [1], Illumina [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-190b-3p |
|
Accession | MIMAT0017267 |
Previous IDs | mmu-miR-190b* |
Sequence |
48 - acugaaugucaagcauacucuca - 70 |
Deep sequencing | 310 reads, 62 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|