Accession
MI0005545
Symbol
HGNC:
MIR190B
Description
Homo sapiens
hsa-mir-190b precursor miRNA
Gene family
MIPF0000076;
mir-190
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Hsa-mir-190b, an miRNA, was found to be upregulated and involved in the regulation of FGF2 downregulation, which in turn alleviated the inflammatory response and vascular endothelial injury [PMC8923688]. Additionally, hsa-mir-190b was found to activate the expression of FGF2 and FGFR1 proteins [PMC8923688]. On the other hand, hsa-mir-190b and hsa-miR-449a were identified as the most significantly downregulated miRNAs [PMC7499949]. The upregulation of hsa-mir-190b suggests its potential role in modulating FGF2 expression [PMC8923688]. This regulation of FGF2 may contribute to the alleviation of inflammatory response and vascular endothelial injury [PMC8923688'>PMC8923688'>PMC8923688'>PMC8923688]. The activation of FGF2 and FGFR1 protein expression by hsa-mir-190b further supports its involvement in cellular processes [PMC8923688]. In contrast to its upregulation, hsa-mir-190b was found to be downregulated along with hsa-miR-449a [PMC7499949]. This downregulation suggests a potential role for these miRNAs in different cellular processes or pathways [PMC7499949]. In summary, hsa-mir-190b is an miRNA that is upregulated and involved in regulating FGF2 expression [PMC8923688]. This regulation may contribute to alleviating inflammatory response and vascular endothelial injury while activating FGF2 and FGFR1 protein expression [PMC8923688]. Additionally, both hsa-mir-190b and hsa-miR-449a were significantly downregulated [PMC7499949] [PMC8923688].
Literature search
49 open access papers mention hsa-mir-190b
(225 sentences)
(225 sentences)
Sequence
3141
reads,
65
reads per million, 66 experiments
ugcuucugugUGAUAUGUUUGAUAUUGGGUUGuuuaauuaggaaccaACUAAAUGUCAAACAUAUUCUuacagcagcag
((((.(((((.(((((((((((((((.((((((((......))).))))).)))))))))))))))..))))).)))).
((((.(((((.(((((((((((((((.((((((((......))).))))).)))))))))))))))..))))).)))).
Structure
- u -U G - aa ugcu cugug GAUAUGUUUGAUAUU GGUUG uuu u |||| ||||| ||||||||||||||| ||||| ||| acga gacau UUAUACAAACUGUAA UCAac aag u g c UC A c ga
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr1: 154193665-154193743 [-]
Disease association
hsa-mir-190b is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-190b-5p
| Accession | MIMAT0004929 |
| Description | Homo sapiens hsa-miR-190b-5p mature miRNA |
| Sequence | 11 - UGAUAUGUUUGAUAUUGGGUUG - 32 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-190b-3p
| Accession | MIMAT0037332 |
| Description | Homo sapiens hsa-miR-190b-3p mature miRNA |
| Sequence | 48 - ACUAAAUGUCAAACAUAUUCU - 68 |
| Evidence | not_experimental |
References
|
