miRBase entry: mmu-mir-877

Stem-loop mmu-mir-877


Accession
MI0005553
Symbol
MGI: Mir877
Description
Mus musculus mmu-mir-877 precursor miRNA
Gene family
MIPF0000392; mir-877

Literature search
17 open access papers mention mmu-mir-877
(25 sentences)

Sequence

10471 reads, 104 reads per million, 102 experiments
GUAGAGGAGAUGGCGCAGGGgacacaagguaggccuugcgggucuguggacccuuggacaugUGUCCUCUUCUCCCUCCUCCCAg
...((((((..((.(.((((((((((..((...((....(((((....)))))..)))).)))))))))).).))))))))....

Structure
-GUA      AU  C C          ag  agg  uugc     u 
    GAGGAG  GG G AGGGgacaca  gu   cc    ggguc g
    ||||||  || | ||||||||||  ||   ||    |||||  
    CUCCUC  CC C UCUCCUGUgu  ca   gg    cccag u
gACC      --  U U          -a  ---  --uu     g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr17: 35960730-35960814 [-]

Database links

Mature mmu-miR-877-5p

Accession MIMAT0004861
Description Mus musculus mmu-miR-877-5p mature miRNA
Sequence 1 - GUAGAGGAGAUGGCGCAGGG - 20
Evidence experimental
cloned [1-2], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-877-3p

Accession MIMAT0004862
Description Mus musculus mmu-miR-877-3p mature miRNA
Sequence 63 - UGUCCUCUUCUCCCUCCUCCCA - 84
Evidence experimental
cloned [1-2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  5. PubMed ID: 17964270
    Mammalian mirtron genes
    "Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC"
    "Mol Cell (2007) 28:328-336