miRBase entry: mmu-mir-598

Stem-loop mmu-mir-598


Accession
MI0005556
Symbol
MGI: Mir598
Description
Mus musculus mmu-mir-598 precursor miRNA
Gene family
MIPF0000393; mir-598

Literature search
1 open access papers mention mmu-mir-598
(1 sentences)

Sequence

55598 reads, 183 reads per million, 93 experiments
gcugaugcugGCGGUGAUGCCGAUGGUGCGAGCugaaaaugggcugcUACGUCAUCGUCGUCAUCGUUAucaucaucau
(.(((((.(((((((((((.(((((((((.((((.......)))))).))..))))).))))))))))).))))).)..

Structure
-- c     c           C     --  -  G    ga 
  g ugaug ugGCGGUGAUG CGAUG  GU GC AGCu  a
  | ||||| ||||||||||| |||||  || || ||||  a
  c acuac AUUGCUACUGC GCUAC  CA cg ucgg  a
ua u     u           U     UG  U  -    gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
chr14: 63727189-63727267 [+]

Database links

Mature mmu-miR-598-5p

Accession MIMAT0017283
Description Mus musculus mmu-miR-598-5p mature miRNA
Sequence 11 - GCGGUGAUGCCGAUGGUGCGAGC - 33
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature mmu-miR-598-3p

Accession MIMAT0004942
Description Mus musculus mmu-miR-598-3p mature miRNA
Sequence 48 - UACGUCAUCGUCGUCAUCGUUA - 69
Evidence experimental
RAKE [1], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298